pedal single o doble?

Amigos batakas, les keria preguntar que opinan. No se si desarrollar primero mi pierna derecha, con un solo bombo, o empezar con ambas piernas a la vez, es decir doble pedal en mi caso...
Otra cosa, cual es la diferencia entre esta seccion del foro y la de trucos sobre tecnica ?? nunca he sabido bien en cual postear lo que necesito.



Yo creo que la clave es empezar con el pie derecho en el bombo y el pie izquiero en el charles. La clave es saber interpretar las blancas, negras, corcheas... con el pie de charles mientras tocas. Eso con el tiempo te ayudará con el boble pedal porque estás ejerciendo el pie.

Sobre el tema de la diferencia entre "Técnicas y Trucos" supongo que radica en que Técnicas es para mejorar el nivel de cada uno con redobles, etc... y trucos sería pues hacer remedios caseros para herrajes, colocación batería, y demás. Entiendes? No sé si me he explicao bien.



Para empezar yo soy partidario del simple. Primero te familiarizas con lo basico y poco a poco cuando veas que te "aburres" con lo que tienes pos no pruebas con el doble pedal, mas toms, mas platos.... Pero no de principio meterse en la bateria de Mike Portnoy (la de tres bombos) porque sino creo que la mitad del foro (dodne me incluyo) estariamos mas perdidos que un hijo puta el dia del padre XDD

En resumidas, que en principio prueba con lo basico y con el tiempo pos vas probando....
esta claro ke el doble pedal nunk te va a sobrar.....pero yo ke tu empezaria primero kon un pedal simple y luego con doble pedal. saludos!
En mi opinion personal, es muy recomendable comenzar de una ves con doble pedal, ya que el Hihat siempre va a estar presente y asi se trabajan los dos pies por igual,en mi caso comense con el pedal simple y hihat, y ahora que uso doble pedal desde ya hace varios años, el pie derecho le lleva una morena en resistencia y velocidad al izquierdo por mas que entrene o practique o estudio con el izquierdo solo, lo mejor es trabajarlos juntos, es como trabajar una mano en el Hihat y otra en la caja solamente y despues las dos manos en la caja.


estoy con mi compatriota gabrisapiens yo empeze trabajando los 2 pies al mismo tiempo osea empeze con doble pedal , pero igual con el tiempo el pie derecho automaticamente agarra mas agilidad fuerza y precision q el izquierdo.La cosa es tratar de q la diferencia no sea muy alta entre la pegada de los 2 pies
Hola q tal?
Yo soy partidario de usar el pedal sencillo al doble; creo q es mas bonito, importante y dificil utilizar el hi-hat de forma correcta a q te metas directamente con el doble pedal, por q eso de q el hi-hat siempre esta ai, no me suena bien, mi maestro (no profesor, por q no me cobraba) me enseño q era mas interesante trabajar el hi-hat q el bomobo, en un principio no pensaba como él, pero ahora me doy cuenta de la razón q tenía; también soy de la opinión de q con un solo pedal se puede hacer de todo (caña, adornos, detalles), es mas dificil al tener un solo pedal, pero si curras tanto phi-hat como bombo se consiguen cosas con mucha miga.
Jajajaja, de verdad a mi no me importa mucho eso de que sea bonito, jajajajaja, sin animos de burlas ni ofensas, ok?solo que me dio burda de risa eso

Lo que si digo es que bueno, tengo un amigo que me dice casi lo mismo, si esta de acuerdo en iniciar de una ves con doble pedal, pero dice que todo lo que se hace con un doble pedal se hace con uno simple, pero eso es falso, he visto bateristas muy buenos y muy rapidos en el pedal simple, pero ninguno puede hacer lo que hacer Dereck Roddy con un solo pedal, esto no quiere decir que sea bueno o malo, pero hay que estar claro en eso.
Buddy Rich era un Turbo con su pedal simple, Jojo Mayer tambien, y asi varios, pero ninguno puede quedarse mucho tiempo y a buen volumen y velocidad siquiera cercana un ritmo o Fill a la que tocan muchos bateros de genero Extremo como dije antes Dereck Roddy, que es el que me ha parecido el mas rapido y duro hasta ahora, repito, no por eso Dereck es mejor que Jojo Mayer, ni vice versa, solo digo que es mucho mas comodo facil y mejor utilizar la herramienta del doble pedal, es como si quisieras tocar la caja solo con la mano Izquierda pues la derecha esta en el Ride o Hihat


Multifonico dijo:
Amigos batakas, les keria preguntar que opinan. No se si desarrollar primero mi pierna derecha, con un solo bombo, o empezar con ambas piernas a la vez, es decir doble pedal en mi caso...
Otra cosa, cual es la diferencia entre esta seccion del foro y la de trucos sobre tecnica ?? nunca he sabido bien en cual postear lo que necesito.

Desde mi experiencia personal, y siempre teniendo en cuenta que no sé que nivel tienes de técnica, conocimientos, etc. te aconsejaría que empezaras por el pedal simple. Sobre todo para desarrollar bien lo que es el ritmo la "descoordinación" entre los cuatro miembros, y los cambios en los temas. Por eso te digo lo de tu nivel. Si ya eres capaz de hacer todo eso, de mantener un tema de principio a final sin irte de tempo, ni de ritmo, ni nada entonces podrías pasar al doble pedal.

También influye el tipo de música que vayas a hacer con tu grupo o tú en solitario. En mi caso el doble pedal lo tengo casi más como adorno que otra cosa, porque el rock and roll que hago no lo necesita. Suelo usarlo más bien al final de los temas, cuando te quedas haciendo mucho "ruido" platos, toms, etc y entonces sí meto el doble pedal. Pero de resto lo uso mu poquito. :batera:

Ea, un saludo :u:
batraquilla dijo:
Suelo usarlo más bien al final de los temas, cuando te quedas haciendo mucho "ruido" platos, toms, etc y entonces sí meto el doble pedal. Pero de resto lo uso mu poquito.

shhhhh ruido no,MUSICA que despues dicen que somos unos brutos que solo aporreamos latas :lol: :lol:
Ni me enfada ni me ofende gabrisapiens, pero o no lo entiendes o no lo quieres entender el decir "bonito" aplicandolo a la batería ni sus técnicas.
Por cierto no he dicho q se pueda hacer lo mismo con un pedal sencillo y uno doble.
Yo tenía un doble (Yamaha), me lo robaron y ahora estoy esperando otro, pero con esto no echo por tierra mi anterior comentario.
Ya sabes gustos y colores.
Hola! Yo creo que lo suyo es empezar poco a poco, con un set de lo mas basico y luego, conforme vas controlando y exprimiendo todo lo que tienes, ir ampliando el kit. Al fin y al cabo el doble pedal no es mas que el sustituto de un segundo bombo (por espacio, comodidad, pelas o facilidad de transporte). Es como si de golpe te metes pa empezar en una bateria con 2 bombos, 4 crashes, 5 splashes, 3 chinas, 2 cajas, octobans, rototoms, 4 aereos, 2 bases, cortinas, crotalos, pads electronicos.... En fin, algo parecido a la tienda que leva el Sr D. Mike Portnoy. Cuando lo controles lo vas a pasar genial, pero lo realmente chulo es tener un kit pequeño y hacer que suene como si fuese grande. Y lo del doble pedal desde el principio, bueno, opiniones cada uno tendra la suya, pero yo creo (y espero) que con practica practica y mas practica pueda poner mi pie izquierdo al nivel de mi derecho. Lo del charles es increible lo que se puede hacer con el, y pienso que sacrificando desde el principio esas posibilidades puedes estar perdiendo mucho. Te lo digo porque he visto gente que desde el primer dia toca con doble pedal y vale, hacen un tacatacatacatacatacatacataca muy rapido, pero luego no les pidas que te abran el charles porque no. Y he visto gente que lo flipabas de las movidas que te hacian con el charles, y luego con el doble pedal son unos fieras, trabajando la pegada del izquierdo. En fin, sin animo de rallar, mi opinion es que antes de echar a corre hay que aprender a andar, creo que lo han dicho por ahi arriba, pero si es asi, lo suscribo.