abusa del doble bombo???????

Tema en 'Off topic' comenzado por godofredo, 12 de Febrero de 2007.

  1. pues acabo de escuchar el nuevo single de skizoo, despues de escucharlo un par de veces me ha gustado, pero me he quedao con una sensacion: creo que abusa bastante del doble bombo. ojo, no pongo en duda la calidad de dani perez. me encanta este tio. es un crack, me he escuchado mil veces el primer disco de skizoo y es una maquina. ojala algun dia tocara yo la mitad de bien que toca el. quede claro que no pretendo juzgar, porque no soy nadie para eso, simplemente hablo de gustos. de si personalmente os gusta la bata que le pone a la cancion.

    pero como decia hace poco en un post, una de las dificultades para un bateria, es, no solo saber hacer trullos y ritmos complicados y dificiles (cosa que dani perez hace muy bien) sino tambien hacer la bata que la cancion pide, ni mas ni menos.

    esta claro que esto ya depende de los gustos. como ya sabeis a mi me gusta la musica mas tranquila (incluso la comercial), quizas por lo que estoy acostumbrado a oir, me parezca le bata de esta cancion sobrecargado con el doble bombo. a otros os parecera que hasta se queda corto

    pues eso,me gustaria saber vuestra opinion, os parece que abusa del doble bombo?
    la cancion en cuestion es esta:
    http://www.youtube.com/watch?v=9JGgebq83Xo

    y ya que estamos, otras canciones en la que creais que la bateria es excesiva para la cancion-estilo?

    de veras me gustaria saber vuestra opinion, gracias!
     
  2. wenas

    pos a mi m gusta bastante desde luego a una sola escuxa supongo que con mas escuchas me molara mas, no creo que sea un uso excesivo de doble bombo esque es su estilo es DANI PEREZ no se

    un saludo
     
  3. ya ya, si puede ser el estilo de dani perez, pero a veces puede ser mque el estilo de uno, no sea el del estilo del grupo, de ahi la dificultad por amoldarse a lo que el grupo pide. y con esto no digo que no le meta doble bombo, pero tampoco tanto ( mi punto de vista , claro)
    pos ciesto, no me sale lo de poner directamente el video y no de porque es, borro todo lo que va delante del "v=" inclido esto, lo que queda lo pincho con el reton y le doy al boton del youtube, pero nada de nada
     
  4. Hombre, en la parte del estribillo es demasiado continuado para mi gusto, pero por lo demas, me parece que esta bien, aunque quiza si abuse un poquillo jeje

    Un saludo.
     
  5. yo si creo que abusa del doble bombo ahi.
    El bajo hace:
    Bommmm bommmmm bommmmmmm
    y el hace
    TACATACATACATACATACATACATACA

    y queda algo sobrecargado.
     
  6. pues a mi el tema me encanta y no le cambiaria nada de ningun instrumento, me parece una pasada.
     
  7. pues a mi me gusta mucho
    y me parece perfecto el doble bombo que hay
     
  8. Mmmmm... tal vez, tal vez, pero a veces eso que dices es justamente lo adecuado. Sí, podía haberlo roto un poco, no ser tan lineal, darle una vueltecilla de tuerca en algún punto, pero... pero es una canción hecha para gustar a la primera escucha, estoy seguro de que debió sopesarlo -este hombre sabe tocar con dos mazas-, tal vez yo lo hubiera dejado así también, es muy directa... No hay que olvidar que quieren vender discos y gustar, no sé si me explico...
     
  9. Pues no es un tema especialmente cargado de doble pedal, realmente sólo lo lleva en plan continuo a semis con algún adorno en los estribillos y en el sólo de guitarra, y sin hacer demasiadas filigranas... me parece una batería bastante acorde al tema :batera:
     
  10. Kizas si cambiara el patron del doble bombo, con algun ritmo no tan continuado.

    Por cierto, vaya configuracion rara ke lleva eh?
     
  11. A mí me gusta como está la canción. Pero en general no me gusta su estilo de doble bombo, en Saratoga me daba mucha jena.
     
  12. ami la cancion no me gusta demasiado jeje pero no me parece k kede mal el doble bombo en el estribillo.
     
  13. A mi me parece que para un grupo como este si está sobrecargado, el adorno ternario en los últimos compases de los estribillos le quita peso, creo que hay maneras de subir la intensidad de una parte mucho más finas, por otro lado los adornos de las estrofas y en el interludio me parecen de chapeau, muy bien.
    Por otro lado, hay que reconocer que el grupo tiene un enfoque bastante comercial, y los términos comercial y doblebombo no suelen casar muy bien.
     
  14. Pues , sintiendo mucho poner la nota discordante, creo que se pasa tres pueblos, y mientras (para mí) grupos como helmet usan un doble con menos filigranas pero que empasta a la perfección con cada acorde y cada nota del bajo, aquí parece que el tío está pensando : vais a ver cómo toco. En Saratoga , todavía podía estar bien , aquí me parece que no toca lo que debe tocar, se pasa mucho, otra cosa es que sea un crack, que lo es. El estribillo es repetitivo y los tripletes de las estrofas no me acaban de convencer mas q como diciendo : aqui estoy yo. Otra cosa es que después de venir de Saratoga, el pive se aburra si no lo zurra de lo lindo, pero por ejemplo, el papel que hacía el desgraciadamente desaparecido Alberto Madrid en Sober y Savia era perfecto, ni mucho ni poco, lo justo y a mí no me aburría en una sola nota de más o de menos. Me parecía un millón de veces más creativo sin tener que apisonar a lo bestia. Pero es sólo mi opinión. Un saludo.
     
  15. yo creo que no abusa....para mi gusto lo mete d.p.m.....creo....pero vamos que comparao con saratoga....juas!!se queda corto!

    salud!
     
  16. Pues yo a este bateria lo pude ver con Saratoga y la verdad es que lo hace muy bien el tio, en este tema no me parece que se pase demasiado... pero nose...
    Eso si como persona deja mucho que desear (al menos eso me parecio a mi)
    Un saludo!
     
  17. Pues a mi me parecio to lo contrario, tuve la oportunidad de entrevistarlo una vez y me parece un tio muy modesto y simpatico
     
  18. no se, quizas si que en el estribillo no me acaba de convencer...pero de todas formas todo los demas me encantó!
    y si que lñleva configuracion rara...como no tiene doble bombo?? como no tiene mil platos?? porque si es famoso lleva configuracion a lo cutre?? quizas no necesite mas...pero estoy acostumbrado ver a los famosos rodeaos de platos y toms...(vease Danny Carey con su gong detras...lo mismo Nicko McBrain...)
    Bueno eso, na mas!
     
  19. Yo creo que han intentado mantener la contundencia de la canción en el estribillo, allí donde las guitarras y el bajo se vuelven más melódicos, mediante el nombrado doble bombo. Para mi SI que abusa.
    No obstante la parte más contundente, me parece que está sobre el 2:50 de la canción y no tiene doble bombo, ...mmm... ...cañita brava... ...eso pesa más que el ego de Ulrich :metal: .
    Me tengo que hacer con este segundo trabajo.

    Saludotes
     
  20. A mi personalmente no me gusta el uso del doble bombo en una canción al estilo maquina de hacer semis i tresillos, igualmente que con la caja no estàs todo el rato haciendo lo mismo. Para mi es mucho más importante el groove. Para el estilo de éste grupo está bien, no abusa vamos, pero no me gusta nada. El doble bombo es mucho màs interessante en los adornos y en los fills y los solos. Los baterias no somos máquinas metronómicas, somos músicos, almenos algunos de nosotros.:batera::batera::batera:El ritmo se lleva dentro y hay que extriorizarlo.
     
  21. bueno, despues de 20 respuestas queda una cosa clara:
    gustos como colores
    a mi sigue pareciendome demasiao doble bombo, pero queda claro que a muchos os gusta y a dani perez tambien le gustara cuando lo ha metido asi que......
    gracias por las respuestas!
     
  22. a mi la verdad es q me ha gustado..quiza en el estribillo si le podia meter algun adornillo mas..pero luego se le acusa de q sobrecarga las canciones, asi q estamos en las mismas.
    el caso es q llego a la misma conclusion que godofredo, pa gustos los colores..esto es asi ;)
     
  23. personalmente a mi las canciones con un doble bombo tan lineal no me molan mucho. Dicho esto, creo k el final del estribillo con el bombo a toa leche keda mu wen (alguien k m aclare k figuras utiliza en esa parte) pero le kita contndencia el llevarlo desde el principio del estribillo metido a un ritmo mas lento. Aun asi, toca realmente de pm, asi k todo lo k digo son apreciaciones de tipo gusto musical.
     
  24. Que bateria usa?
     
  25. yo no lo veo tan pasao de doble bombo, pero si es verdad que creo que a esta gente tanto seguido les puede empachar un poco.....
    por cierto, vaya guitarron que me gasta el nota, es una Randy Rhoads limited edition, no? (si es que hay alguien puesto en guitarras, claro...)
     

Comparte esta página